rip normal mouse igg  (Santa Cruz Biotechnology)

Journal: Bio-protocol

Article Title: Ribonucleoprotein Immunoprecipitation (RIP) Analysis

doi: 10.21769/BioProtoc.3488

Figure Lengend Snippet: A. Schematic of the ribonucleoprotein immunoprecipitation (RIP) assay protocol. B. The association of the RBP NF90 (used here as example) with ACTB and BAFF mRNAs was tested by RIP analysis using anti-NF90 antibody. Following RNA extraction, the abundance of BAFF and ACTB mRNAs in NF90 IP and IgG IP control samples was assessed by RT-qPCR analysis using mRNA-specific primers (ACTB: CATGTACGTTGCTATCCAGGC and CTCCTTAATGTCACGCACGAT; BAFF: CACAATTCAAAGGGGCAGTAA and ACTGAAAAGGAGGGAGTGCAT; UBC: ATTTGGGTCGCGGTTCTTG and TGCCTTGACATTCTCGATGGT). These results were normalized to the levels of UBC mRNA in each sample, and then plotted as the enrichment of mRNAs in the NF90 IP relative to the BAFF and ACTB mRNA levels observed in the IgG IP samples. C. After IP using anti-NF90 or IgG antibodies, the presence of NF90 in the IP material was confirmed by Western blot analysis.

Article Snippet: For NF90 RIP, we use normal mouse IgG control (Santa Cruz Biotechnology, catalog number: sc-2025) DNase I (RNase-free) (Thermo Fisher Scientific, catalog number: AM2222) RiboLock RNase inhibitor (40 U/μl) (Thermo Fisher Scientific, catalog number: EO0381) Random primers (100 μM) (Thermo Fisher Scientific, catalog number: SO142) dNTP mix (10 mM each) (Thermo Fisher Scientific, catalog number: R0192) Maxima TM reverse transcriptase (Thermo Fisher Scientific, catalog number: EP0741) and 5x RT buffer (provided with Maxima Reverse Transcriptase) Proteinase K Solution (20 mg/ml) (Thermo Fisher Scientific, catalog number: AM2546) Nuclease-free water (Thermo Fisher Scientific, catalog number: AM9930) Dulbecco’s phosphate-buffered saline (DPBS) (Thermo Fisher Scientific, catalog number: 100100-15) Halt Protease & Phosphatase inhibitor cocktail (100x) (Thermo Fisher Scientific, catalog number: 78442) TRIzol TM (Thermo Fisher Scientific, catalog number: AM9738) DTT (Sigma-Aldrich, catalog number: 43815) UltraPure 1 M Tris-HCl (pH 7.5) (Thermo Fisher Scientific, catalog number: 15567-027) 1 M KCl solution (Sigma-Aldrich, catalog number: 60142) 1 M MgCl 2 solution (Sigma-Aldrich, catalog number: M1028) 0.5 M EDTA (Thermo Fisher Scientific, catalog number AM9261) 5 M NaCl solution (Sigma-Aldrich, catalog number: 71386) 20% SDS solution (Sigma-Aldrich, catalog number: 05030) GlycoBlue TM (15 mg/ml) (Thermo Fisher Scientific, catalog number: AM9515) KAPA SYBR ® FAST ABI prism 2x qPCR master mix (Kapa Biosystems, catalog number: KK4605), or SYBR Green from other vendors Nonidet TM P-40 (IGEPAL ® CA-630, Sigma, catalog number: I8896) Chloroform (Sigma-Aldrich, catalog number: C2432) Isopropanol (Sigma-Aldrich, catalog number: I9516) Ethanol (Sigma-Aldrich, catalog number: 51976) Bio-Rad Protein Assay Dye Reagent Concentrate (for Bradford assay) (Bio-Rad, catalog number: 5000006) Polysome extraction buffer (PEB) (see Recipes) NT2 buffer (see Recipes)

Techniques: Immunoprecipitation, RNA Extraction, Control, Quantitative RT-PCR, Western Blot